Race were carried out using the smarter race cdna amplification kit clontech, mountain view, ca, usa following the manufacturers protocol. However, in this case, the original protocol of cdna synthesis requires special modifications. For the first pcr amplification of 3 race, dtsd31 5. Our carefully designed, speciallymodified smarter oligo preferentially captures the 5 ends of the cdna during cdna synthesis. Libraries generated with the pico v1 or pico v2 kits were pooled and run on nextseq 500 or miniseq instruments, as indicated. Smarter pcr cdna synthesis kit user manual protocol no. Improved passfilter rates %pf with the smarter stranded total rnaseq kit v2 pico input mammalian. A solution to this problem can be found in clontechs smart cdna synthesis kit.
I plan to perform 5 race pcr using either the smarter kit from clontech or the invitrogen kit 5 race system for rapid amplification of cdna. For marathonready cdnas, cdna synthesis and adaptor ligation are performed at clontech 5 andor 3 race can be completed in one day. Clontech labs 3psmarter race 53 kit, 20 rxns fisher scientific. The infusion hd cloning kit, nucleospin gel and pcr cleanup kit, and stellar competent cells are included for your convenience in cloning race products. Cloning fulllength transcripts and transcript variants. The smarter ii a oligonucleotide anneals to the tail of the cdna and serves as an extend ed template for smartscribe rt. Smarter cdna synthesis for rapid amplification of cdna ends race. In the molecular biology arena, race refers to rapid amplification of cdna ends, a pcrbased cloning strategy used to obtain clones representing transcripts of the int2 gene, expressed at low abundance.
This kit incorporates takara bios proprietary smart switching mechanism at the 5 end of rna template technology and includes refinements to the smarter method for stranded rnaseq that simplify. General considerations for bd smart race amplification 11 v. Smarter stranded total rnaseq kit v2 pico input mammalian. The polymerase mix is comprised of titanium taq dna polymerasea. The smarter race 53 kit has been improved to accommodate larger rna input volumes and perform better on challenging targets than the original smarter race cdna amplification kit. Kit, designed to accommodate larger rna input volumes. Applications such as northern blot analysis, cdna library construction and cdna subtraction are demanding when it comes to starting material. Smart race cdna amplification kit user manual table of contents i. Rapid amplification of cdna ends race rapid amplification of cdna ends race is a technique used in molecular biology to obtain the full length sequence of an rna transcript found within a cell. General considerations for smart race amplification 11 v.
Here we describe a reversetranscriptasebased method for obtaining fulllength cdnas using the smarter switching mechanism at rna termini race technology developed by clontech. We performed 5 race with the smarter race complementary dna cdna amplification kit 634859. Alternatively, cdna compatible with trimmer2 protocol can be prepared using clontech smarttm cdna library construction kit cat. Marathon cdna amplification kit perelman school of. A novel biomarker for marine environmental pollution of. And the race is on to obtain that potentially elusive fulllength cdna for characterizing the best gene ever. Clontech labs 3psmarter race 53 kit, 10 rxns fisher. What is the best race kit for amplify full cdna genes. I suggest you follow the exact protocol from clontech, and use everything they provided, as pratima. The expression of porcine prdx6 gene is upregulated by c. Polymerase chain reaction amplification programme was set as follows. This abbreviated protocol is provided for your convenience, but is not intended for firsttime users.
Aug 14, 2015 the cdna synthesis was carried out using the primescript rt reagent kit with gdna eraser following the manufacturers instructions takara, otsu, japan. The pcr for 5 race and 3 race was performed using smarter race cdna amplification kit clontech, japan following the user manual. The same master mix can be used for both 5 and 3 race reactions. The 3 race ready cdna and 5 race ready cdna were used as templates for 3 race and 5 race respectively. Generating raceready cdna section v of the user manual. To generate race ready cdna, the smarter race cdna amplification kit was used following the user manual clontech, mountain view, ca, usa. Smarter race cdna amplification kit user manual protocol no. Clontech labs 3p smarter race 53 kit, 20 rxns manufacturer. The genespecific primers were designed and synthesized according to the above sequenced 3.
I plan to perform 5 race pcr using either the smarter kit from clontech or the invitrogen kit 5 race system for rapid amplification of cdna ends, version 2. Smarter race cdna amplification kit clontech laboratories, inc. Race pcr products are amplified with our highly robust seqamp dna polymerase, and cloned into the linearized prace vector with infusion. Bd advantage 2 pcr enzyme system user manual bd advantage 2 pcr kit cat. Characterization of bmp15 and its regulation by human. Smartscribe rt then switches templates and continues replicating to the end of the oligonucleotide chenchik et al. This document describes methods for generating fulllength cdna libraries. Race results in the production of a cdna copy of the rna sequence of interest, produced through reverse transcription, followed by pcr amplification. Smart race kit is also creatorcompatible, so it can be used to prepare cdna for product size cat. Clontech s smart race cdna amplification process diagram on your mark, get set, go. Smarter stranded total rna sample prep kit hi mammalian. Improved sequencing performance with the smarter stranded total rnaseq kit v2 pico input mammalian.
Molecular characterization, tissue expression of acylcoa. Which is the best kit for race ready cdna synthesis. Race cdna amplification kit user manual now including. A novel biomarker for marine environmental pollution of cat. If the input rna is not high quality, the result is a cdna library that will show an overall 3 bias. Clontech products are to be used for research purposes only. For the race pcr reaction, two genespecific primers, fad93rf and fad95rr table 1, were designed based on the obtained acylcoa.
Workflow for cdna preparation with the smarter apollo system and the smartseq v4 reagent kit for the smarter apollo system. Molecular cloning, characterization and expression. Dna methyltransferases have an essential role in female. Bd smart race cdna amplification, bd clontech pcrselect subtrac. In a lobind microcentrifuge tube, add the following reagents. M 5aagcagtggtatcaacgcagagtact30 v n3 n a, c, g, smarter. Instructions for firststrand cdna synthesis, from the clontech smarter pcr cdna synthesis kit, have been. Smarter race cdna amplification kit user manual hackbio. Flowery odor formation revealed by differential expression of. The smarter stranded total rnaseq kit v2 pico input mammalian is used to generate strandspecific rnaseq libraries for illumina sequencing from 250 pg10 ng inputs of purified total rna.
Flowery odor formation revealed by differential expression. The smarter pcr cdna synthesis kit does not differentiate between a fulllength mrna sequence and that of a degraded mrna fragment. The 3 and 157 5ends cdna templates were synthesized according to the user s manual. Race was performed using a smarter race cdna amplification kit clontech, usa, according to the manufacturers user manual. Pr661862 smart race cdna amplification kit user manual.
Clontech labs 3psmarter race 53 kit, 20 rxns fisher. Race kit rapid amplification of cdna ends is used for amplification of 3 or 5 of cdna. The smarter race 53 kit is an improved version of our original smarter race cdna amplification. The smarter pcr cdna synthesis kit includes the same components as the original smart pcr cdna synthesis kit plus an improved smarter ii a oligo and smartscribe reverse. Bd smart race cdna amplification kit user manual i. Please read the user manual for the smarter race cdna amplification kit cat. Race products for various rna targets using the neb template switching rt enzyme mix 5. Smarter race cdna amplification is a flexible toolmany researchers use this kit in place of conventional kits to amplify just the 5 or 3 end of a particular cdna. Clontech 2009 smarter race cdna amplification kit user manual.
Smarterrace cdna amplication kit user manual protocol pt40961. With the workflow described in this user manual, synthesis and purification of cdna from any number of samples can be completed in approximately 910 hours, prior to validation figure 1. Introduction smarter cdna synthesis for the illumina sequencing platform the smarter stranded total rna sample prep kit hi mammalian cat. The incorporation of bd smart technology also permits. A gc1qr prevents white spot syndrome virus replication in.
To increase the amplification efficiency and specificity, the race pcr product was diluted 100. Race were carried out with smarter race cdna amplification kit user manual clontech with specific primers for 5. Molecular cloning, characterization and functional. The kit utilizes our smart switching mechanism at 5 end of rna template technology coupled with pcr amplification to generate high yields of fulllength doublestranded cdna suitable for various applications, including clontech pcrselect cdna subtraction, nondirectional cloning, and preparation. Clontechs smart cdna synthesis kit biocompare product. Smarter stranded total rna sample prep kit hi mammalian user manual 082614. Clontech smarter pcr cdna synthesis kit with no size selection no 1. Please read the user manual for the smarter race 53 kit cat.
Race system for rapid amplification of cdna ends, version 2. A takara bio company page 7 of 34 synthesize smarter cdna for rapid amplification of cdna ends race the smarter cdna synthesis method is also optimized for rapid amplification of cdna ends race. Smartseq v4 reagent kit for the smarter apollo system. Race ready firststand cdna according to the smarter race cdna amplification kit user manual clontech. Can anyone suggest basic protocol for 5 and 3 race pcr. Smarter pico pcr cdna synthesis kit user manual 020916. Four 158 genespecific primers, elovl4f1, elovl4f2, elovl4r1 and elvol4r2 were designed 159 for the amplification of race cdna fragments based on the obtained elovl4 cdna. Different routes of aeromonas hydrophila infection lead to. Introduction protocoloverview, continued following reverse transcription, smart technology allows rststrand cdna useddirectly 3racepcr reactions. Dtsd cdna s 3 end was amplified using 3genespecific primers and the universal primers provided by the kit. The race pcr amplification procedure was carried out using a touchdown pcr according to the manual. User bulletin guidelines for preparing cdna libraries for.
Selectively enhanced expression of prophenoloxidase. The reverse transcription kit utilized for this method, the smarter pcr cdna synthesis kit from clontech, requires the presence of a polyatail in order to generate fulllength cdna. Prepare enough pcr master mix for all of the reactions plus one additional tube. The 5 race ready cdna and 3 race ready cdna templates were prepared according to the smarter race cdna amplification kit user manual. Introduction the smarter race 53 kit provides a method for performing both 5 and 3rapid amplification of cdna. The kit utilizes our smart switching mechanism at 5 end of rna template technology coupled with pcr amplification to generate high yields of fulllength doublestranded cdna suitable for various applications, including clontech pcrselect cdna subtraction, nondirectional cloning, and preparation of complex cdna probes. Bd smart race cdna amplification kit user manual table of contents i.
931 1240 1300 925 124 568 1101 1376 145 977 1206 707 382 1442 1274 1416 480 722 15 513